HomeCoronavirusCoronavirus envelope protein activates TMED10-mediated unconventional secretion of inflammatory factors - Nature...

Coronavirus envelope protein activates TMED10-mediated unconventional secretion of inflammatory factors – Nature Communications

This study complied with all of the relevant ethical regulations. All mice experiments were approved by the Institutional Animal Care and Use Committees at Tsinghua University (permission number: 22-ZM5).

Plasmids and cells

The mature form of IL1 family proteins (IL1α, IL1β, IL18, IL33, IL36α), IL6, TMED10-V5, TMED10∆CT-V5, HA-TMED10, GFP (1-10)-TMED10-V5, mIL1β-FLAG-GFP11 plasmids and mIL1β, TMED10 protein purification plasmids were generated in our previous work17. FLAG-tagged expression plasmids of SARS2 proteins (E, M, S, N, ORF3a, ORF6, ORF7b, and ORF8) were described as previously72. E-SARS2 expression plasmids with or without an N-terminal Myc tag were PCR amplified from the template and inserted into the FUGW vector. Expression plasmids of E proteins of SARS, MERS, 229E, HKU1, OC43 and MHV were generated by DNA synthesize followed by inserting into the FUGW vector with a Myc tag at the N terminus. Mutants of E proteins were constructed by mutagenesis PCR. GFP-ECT was generated by PCR amplification from 38-71aa of E-SARS2 C-terminal and inserted into the FUGW vector with a GFP tag at the N terminus. Myc-E-SARS2, Myc-E-SARS were also inserted into pGEX4T1 or pET28a vector with a GST or MBP tag for protein purification.

HEK293T (from Dr. Randy Schekman), TMED10-KO HEK293T (from our laboratory), U2OS (from Dr. Randy Schekman), BEAS-2B (from Dr. Yu Rao) and 17Cl-1 (from Dr. Fuping You) cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS) and 1% Pen-Strep. THP1 (from Dr. Gong Cheng), TMED10-KO (from our laboratory) and GSDMD-KO THP1 (from our laboratory) cells were maintained in RPMI-1640 medium supplemented with 10% FBS and 1% Pen-Strep. The cells were cultured at 37 °C with 5% CO2. Bone marrow-derived macrophages (BMDMs) were isolated from 6-week-old male C57BL/6 mice and differentiated using standard protocols73.

Reagents and antibodies

The reagents used in this study were purchased from the following sources: DSS (Thermo, 21655), GTP (Roche, 11140957001), ATP (Sigma, A2383), Creatine phosphate (Calbiochem, 2380), Creatine Kinase (Roche, 10127566001), Proteinase K (ABCone, P78893), Phenylmethylsulfonyl fluoride (PMSF) (Beyotime, ST505), Opti-Prep (Serumwerk Bernburg AG, 1893), Protease inhibitor cocktail (Roche, 11697498001), Phosphotase inhibitors (Roche, 4906845001), LPS (Sigma, L2880), Mouse IL-1 beta Uncoated ELISA Kit (Thermo, 88-7013-22), anti-V5 agarose (Sigma, A7345), anti-Myc agarose (Thermo, 20168). Progesterone (S1705), Nitazoxanide (S1627), Leflunomide (S1247), Nitrendipine (S2491), Lomerizine 2HCl (S4084), Econazole Nitrate (S2535), Hexachlorophene (S4632), Hydroxyprogesterone caproate (S4674), Dichlorophen (S5724) all purchased from Selleck, Ulipristal acetate (MEC, HY-N0437) and Progesterone analogs all purchased from MCE.

The antibodies used in this study were obtained from the indicated source: rabbit anti-HA(CST, 3724; WB, 1:5,000), mouse anti-FLAG (Sigma, F3165; WB, 1:5,000), mouse anti-β-tubulin (ZENBIO, 200608; WB, 1:5,000), mouse anti-Myc (CST, 2276; WB, 1:5,000; IF, 1:500), goat anti-IL1β (R&D Systems, BAF401; WB, 1:2,000), rabbit anti-IL1β (Abcam, ab9722; WB, 1:5,000), rabbit anti-GSDMD (CST, 39754; WB: 1:2,000), rabbit anti-IL33 (Proteintech, 12372-1-AP; WB, 1:1,000), rabbit anti-V5 (CST, 13202; WB, 1:1,000; IF, 1:500), mouse anti-V5 (CST, 80076; WB, 1:5,000), rabbit anti-TMED10 (Proteintech, 15199-1-AP; WB, 1:3,000), rabbit anti-TMED2 (Proteintech, 11981-1-AP; WB, 1:3,000), mouse anti-GST (CST, 2624; WB, 1:5,000), rabbit anti-ERGIC53 (Sigma, E1031; WB, 1:2,000), rabbit anti-GFP (CST, 2956; WB, 1:5,000), rabbit anti-Caspase3 (CST, 9662; WB: 1:2,000), rabbit anti-RPN1 (raised against C-terminal peptides corresponding to human protein residues 588–605 and mouse protein residues 576–605; from R. Schekman; WB, 1:5,000) and rabbit anti-E-SARS2 (raised against C-terminal peptides corresponding to the last 25 residues of E-SARS2 protein; purified by ABclonal; WB, 1:1,000). Goat anti-rabbit IgG Alexa Fluor 568 (Invitrogen, A-11011), goat anti-mouse IgG Alexa Fluor 568 (Invitrogen, A-11004) and goat anti-mouse IgG Alexa Fluor Plus 647 (Invitrogen, A32733) were used at a dilution of 1:500 for IF.

Mice

Mice were housed in ventilated cages kept at relatively stable temperature and humidity (20 °C-26 °C, 40%-70%) and light regulated room (12 h light/12 h dark) in a SPF facility and received food and water ad libitum. C57BL/6 J mice were purchased from the Laboratory Animal Resources Center at Tsinghua University. TMED10 fl/fl mice (C57BL/6) were created by GemPharmatech Co. Ltd, China. TMED10 inducible whole body knockout mice were generated via crossbreeding of TMED10 fl/fl with Cre-ERT mice (from Dr. Xiaoyu Hu). 8-week-old male mice were intraperitoneally injected with tamoxifen (80 mg/kg) or corn oil for five continuous days. After the final tamoxifen injection, the mice were fed normally for an additional week before being utilized in an AAV infection experiment.

Transfection, lentiviral transduction and secretion determination

Transfection of DNA constructs into cells was performed using PEI (Polysciences, 23966) for HEK293T and X-tremeGENE HP (Roche, 6366244001) for U2OS according to the manufacturer’s protocols. Lentiviral transduction was used to express TMED10, E, and mutants, GFP and GFP-ECT in THP-1, BEAS-2B or BMDMs. pLX304 plasmids containing the TMED10-V5 or FUGW plasmids containing Myc-E of indicated coronavirus together with pMD2.G and psPAX2 were transfected into HEK293T cells to produce lentiviral particles for 72 h. The supernatant was collected to infect the indicated cells.

For secretion determination, cells were replaced with DMEM for 1 h or induced with 50 ng/ml LPS overnight in RPMI-1640 plus 10% FBS followed by 2 mM ATP treatment for 30 min in physiological saline solution (147 mM NaCl, 10 mM HEPES pH 7.4, 13 mM glucose, 2 mM CaCl2, 1 mM MgCl2, 2 mM KCl). The medium was concentrated by an Amicon filter (Millipore, UFC5010) and cell lysate was collected. Immunoblot was performed to determine the amounts of cargoes in the medium and cell. LDH assay (Thermo, 88953) was performed according to the manufacturer’s protocol.

Immunofluorescence and fluorescence complementation

For immunofluorescence of cultured cells, the cells were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature, permeabilized with 0.1% TritonX-100 diluted in PBS at room temperature for 5 min, blocked with 10% FBS diluted with PBS for 1 h and primary antibody incubation for 1 h. After performing multiple washes, the samples were incubated for 40 min at room temperature with the secondary antibodies74. For lung tissue immunofluorescence staining, samples were fixed in 4% PFA, dehydrated in a 30% sucrose solution for 24 h, and embedded using the Tissue-Tek OCT compound. Frozen blocks were cut into 10-μm-thick sections. Fluorescence images were acquired using the Olympus FV3000 confocal microscope. Quantification was performed using ImageJ.

For fluorescence complementation, the cells expressing GFP(1-10)-TMED10-V5 and IL1β-FLAG-GFP11 were transfected with E plasmids of indicated coronaviruses. The GFP signal in the cells was collected by CytoFlex LX (Beckman) and analyzed by CytExpert software17.

Co-immunoprecipitation and in vitro peptide/GST pull-down assay

Co-immunoprecipitation assay was performed according methods reported previously75. The cells were lysed on ice for 30 min in IP buffer (50 mM Tris/HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.5% NP40, 10% glycerol) with protease inhibitor mixture, and the lysates were cleared by centrifugation. The resulting supernatants were incubated with indicated agaroses and rotated at 4 °C for 3 h. Then the agaroses were washed five times with IP buffer followed by immunoblot.

For peptide pull-down assay, synthetic peptides were conjugated to agarose beads using the AminoLink Plus Coupling Resin (Thermo, 20501) according to the manufacturer’s protocol. 2 mg purified MBP-Myc-E protein of SARS2 was incubated with 20 μL peptides-coupled beads in IP buffer and rotated at 4 °C for 3 h. Then the agarose was washed three times with IP buffer followed by immunoblot.

For GST pull-down assay, the proteins were purified and GST or GST-TMED10 was incubated with Glutathione agarose (GE, 17-0756-05) (which was blocked by 10% FBS) in IP buffer used for Co-IP, and rotated at 4 °C for 1 h. Then the beads loaded with GST or GST-TMED10 were collected and incubated with MBP-Myc-E protein of SARS2 at 4 °C for 2 h. The beads were washed 3 times followed by immunoblot.

Crosslink assay

DSS crosslink assays were performed according to the instructions of the reagents. The cells were suspended in PBS with the 0.25 mM DSS at room temperature for 30 min. The reaction was quenched with 20 mM Tris followed by sample preparation for immunoblot.

Protein purification

For protein purification, pGEX4T1-GST-TMED10, pGEX4T1-GST-Myc-E, pet28a-MBP-Myc-E, pet28a-mIL1β-flag and pGEX4T1-GST-LgBit plasmids were transformed into E.coli ‌Rosetta (DE3), cultured at 37 °C until OD600 reach 0.5-0.8, IPTG (100 μΜ) induced protein expression in 22 °C for 5 h. After expression, the bacteria were collected and lysed with 0.5 mg/ml lysozyme (MP Biomedicine, 100831) in lysis buffer (2×PBS, 10 mM imidazole for His protein purification or 50 mM Tris/HCl pH 8.0, 5 mM EDTA,150 mM NaCl, 10% glycerol for GST protein purification) plus 0.3 mM DTT and PMSF(100 μΜ) on ice for 30 min. Added 0.5% TritonX-100 to lysate, sonicated and centrifuged at 20,000 × g for 40 min. Incubated supernatants with Glutathione Agarose or Ni-NTA Agarose (GE, 17-5318-02) and rotated at 4 °C for 2 h. Washed the agarose with wash buffer contain 0.1% Tween20 and then wash buffer (2×PBS + 25 mM imidazole for His protein or PBS for GST protein). For purification of TMED10 and E, 0.5% Triton X-100 was included in all procedures. The proteins were eluted by elution buffer (2×PBS, 250 mM imidazole for His proteins or 50 mM Tris, pH 8.0, 250 mM KCl, 25 mM glutathione for GST proteins) and concentrated by Amicon Ultra Filters (Millipore, UFC9010). FPLC was performed for buffer exchange and increase of purity. The proteins were frozen by liquid nitrogen and stored in PBS (0.05% Triton X-100 for TMED10 and E) at -80 °C.

In vitro translocation assay

Total lipids extracted from HEK293T cells. Cell suspension and chloroform/methanol solution (methanol: chloroform = 1: 2) were mixed with a ratio 1: 4 by volume, vortexed for 30 s and shaken for 1 h at 180 rpm at 37 °C. After centrifugation at 2000 × g for 10 min at room temperature, chloroform phase was collected and was evaporated by a stream of nitrogen gas over the lipid solution and further dried in 37 °C incubator for 1 h. Dried lipid was suspended in HEPES-KAc buffer (20 mM HEPES, pH 7.2, 150 mM KCl). The phosphatidylcholine (PC) content of lipid solution was measured (Phospholipids C, Wako) and used as a standard to normalize lipid concentration. The lipid was aliquoted and stored in -80 °C.

For reconstitution of proteoliposomes, total lipids were frozen and thawed 10 times in liquid nitrogen and 42 °C water bath. Add 0.05% TritonX-100 into lipid solution and rotated in 4 °C for 30 min. TMED10 and E proteins were added into the lipid solution (10 μg GST-TMED10 protein, 10 μg Myc-E protein and 1.25 mg lipid in each tube) and incubated for another 1 h with rotation. Each 400 μL solution was incubated with 6–8 mg Biobeads SM2 (Bio-Rad) equilibrated with the HEPES-KAc buffer at 4 °C. Beads were replaced each hour and repeated for 5 times (10 mg beads in the third time and incubated overnight). After a 1500 × g centrifugation to remove the Biobeads, the liposome solution was repeatedly frozen in liquid nitrogen and thawed in 42 °C water bath for 5 times. In order to remove the free proteins, a membrane flotation procedure was performed. For each 300 μL solution, 300 μL 50% OptiPrep (diluted in HEPES-KAc buffer) was added. The mixture was overlaid with 480 mL 20% OptiPrep and 90 μl HEPES-KAc buffer, centrifuged at 45,000 rpm (TLS55) for 2 h at 4 °C and the 150 μL top fraction (which contains the proteoliposomes) was collected and diluted with 150 mM HEPES-KAc buffer.

For the in vitro translocation, IL1β protein was added to proteoliposomes (150 μL reaction system contain 6 μg IL1β), incubated for 1 h at 30 °C. After then, an equal volume of 50% OptiPrep (diluted in HEPES-KAc buffer) was added and mixed gently followed by overlaying with 240 μL 20% OptiPrep, 45 μL HEPES-KAc buffer, and centrifuged at 45,000 rpm (TLS55) for 2 h at 4 °C. The proteoliposomes (90 μL fraction from the top) were aliquoted into 3 fractions. The first fraction was a control, the second and third fractions were digested by protease K (15 μg/ml) without or with 0.5% Triton X-100 for 20 min on ice. The reactions were stopped by 1 mM PMSF and incubated for 10 min on ice. Then SDS loading buffer was added and the samples were heated at 100 °C for 10 min followed by immunoblot analysis.

Cell-free translocation assay

The cytosol of wild-type HEK293T cells was prepared followed the research methods reported in the previous literature76. The cells were harvested and washed with PBS followed by passing through a 22 G needle in B88 lysis buffer (20 mM HEPES-KOH, pH 7.2, 250 mM sorbitol, 150 mM potassium acetate, 5 mM magnesium acetate, protease and phosphotase inhibitors, 0.3 mM DTT). The cell homogenates were centrifuged at 100,000 × g for 30 min, after which the supernatant fractions were collected and stored in -80 °C. For cytosol containing GFP or GFP-ECT, HEK293T cells were transfected with the indicated plasmids. For membrane separation, the cells transfected with plasmids expressing TMED10 or different E proteins were harvested and lysed in HB1 lysis buffer (20 mM HEPES-KOH, pH 7.2, 400 mM sucrose, 1 mM EDTA, protease and phosphotase inhibitors, 0.3 mM DTT) by using a 22 G needle. The lysate was centrifuged at 3000 × g for 10 min and the supernatant was ultracentrifuged at 100,000 × g for 30 min to collect the membrane pellet. The pellet was washed with B88 and resuspended in B88 lysis buffer containing the cytosol of wild-type HEK293T cells (3 mg/ml final concentration). The phosphatidylcholine (PC) concentration was measured with a microplate spectrophotometer and adjusted to the equal concentration.

For the cell-free mIL1β translocation, recombinant proteins (120 μL reaction system contain 10 μg T7-mIL1β-flag protein), ATP regeneration system (40 mM creatine phosphate, 0.2 mg/ml creatine phosphokinase, and 1 mM ATP) and GTP (0.15 mM) were added to the purified membrane solution containing 3 mg/ml cytosol, then incubated for 1.5 h in 30 °C. After then, 100 μL reaction system was combined with 200 μL 60% OptiPrep to adjust the final concentration of OptiPrep to 40%, followed by overlaying with 600 μL 30% OptiPrep (diluted in B88 buffer), 100 μL B88 buffer, and centrifuged at 45,000 rpm (TLS55) for 2 h at 4 °C. The membrane fraction floating on the top (150 μL) was collected and aliquoted into three fractions. The first fraction was a control, the second and third fractions were digested by protease K (20 μg/ml) without or with 1% Triton X-100 for 20 min on ice, with a total volume of 40 μL per reaction. The reactions were stopped by adding PMSF and incubated for 10 min on ice. Then SDS loading buffer was added and the samples were heated at 100 °C for 10 min followed by immunoblot analysis.

AAV infection and LPS challenge

The lung-tropic AAV serotype 6 vector expressing GFP, E-SARS2, E-229E and GFP-3×ECT under the control of a CMV promoter were generated by BraninVTA Co. Ltd, China. AAVs were delivered to lung using intratracheal injection technique38. In brief, mice were anesthetized with avertin and a 22-gauge catheter placed into the trachea, then a total of 1 × 1011 vector genomes (vg) AAVs were administered. Four weeks later, mice received an LPS challenge (15 mg/kg) and, 15 hours following the challenge, were euthanized to collect blood serum, lung, spleen, liver, and kidney for analysis using ELISA, immunofluorescence, RT-qPCR and H&E staining.

RNA extraction and RT-qPCR

Total RNA was extracted using Trizol (Beyotime, R0016). Reverse transcription to produce cDNA was carried out by use a cDNA Reverse Transcription kit (Abclonal, RK20429), which contained 1 μg RNA in 20 μL volume. RT-qPCR was carried out by the 2×SYBR Green Master Mix (Abclonal, RK21203). Primers sequences of IL6 and GAPDH are as follows: IL6-F: TGTATGAACAACGATGATGCACTT, IL6-R: ACTCTGGCTTTGTCTTTCTTGTTATCT; GAPDH-F: GTTCCTACCCCCAATGTGTCC, GAPDH-R: TAGCCCAAGATGCCCTTCAGT.

H&E stain and inflammation evaluation

Left lobe of mice lung were fixed in 4% paraformaldehyde, paraffin embedded, and sectioned (7 μm). Tissue sections were stained with hematoxylin and eosin. The severity of lung inflammation was quantified by the percentage of inflammatory area: the area of the regions which immune cell filling to the lung alveolus and increased thickness dividing total area of lung (excluding the air space)77.

MHV infection

Mouse hepatitis virus A59 strain (MHV-A59) was propagated and tilter was determined according to the protocol78. In brief, the virus was propagated in 17Cl-1 cells, subjected to three freeze-thaw cycles between -80 °C and room temperature, centrifuged at 5000 × g for 20 min at 4 °C to remove cell debris, and the supernatant was then concentrated using an Amicon filter. The tilter of the virus was determined by endpoint dilution assay78.

In the cell infection assay, 293T-mCC1a cells were firstly transfected with mIL1β plasmids and cultured for 24 h, then infected with MHV-A59 for 2 h in a serum-free medium, and subsequently cultured in a complete medium containing 10% FBS and 1% Pan-Strep for 36 h. The culture medium was then switched to DMEM for 1 h before collecting the medium to assess mIL1β secretion as described above. To evaluate the impact of drugs, BMDMs were infected with MHV-A59 (MOI 0.1), cultured for 36 h, treated with either DMSO or specific drugs for 4 h in serum-free medium, and the medium was subsequently collected to measure endogenous mIL1β secretion. To examine the impact of ECT, BMDMs underwent lentiviral infection to express either GFP or GFP-ECT and were cultured for 48 h. These cells were then infected with MHV-A59 (MOI 0.1), followed by assessment of endogenous IL1β secretion.

For mice infection assay, 8–12 weeks old IFNAR-KO mice (from Dr. Fuping You) were intranasally inoculated with MHV-A59 (2 × 104 PFU) using isoflurane as the anesthetic. The weight and health status of the mice were observed and recorded daily. Mice were euthanized at 4 dpi to collect serum and different tissues for further testing. To assess drug efficacy, mice were first infected with MHV and then received intraperitoneal injections of DMSO, UPA (1 mg/kg), or Progesterone (1 mg/kg) for three consecutive days, with euthanasia occurring on the fourth day post-infection. Regarding AAV infection, mice underwent initial infection with either AAV-GFP or AAV-GFP-ECT, followed by MHV infection four weeks later.

Compound screening

Rapid secretion analysis assay using complementary NanoLuc leuciferace was employed to screen inhibitors for E-SARS2-induced mIL1β secretion53. 100 nL of compounds and DMSO or H2O controls were added to 96-well plate by Echo 650 Liquid Handler (Beckman). HEK293T cell expression mIL1β-HiBiT and Myc-E-SARS2 were seeded to a 96-well plate, and cultured at 37 °C for 8 h. The medium was collected and each 30 μL medium incubated with Furimazine (10 nM final concentration) and 5 ng LgBit protein in a 60 μL reaction system at room temperature for 10 min. Luminescence was detected using EnSpire Multimode Plate Reader (PerkinElmer). Compounds with fluorescence intensity decreased by more than 0.75-fold relative to control in two independent experiments were selected as candidates.

Statistics and reproducibility

Statistics analyzes were performed using GraphPad Prism 8.0. Micrographs in Fig. 2a, b, and Supplementary Fig S4a are representatives of three independent experiments and were acquired randomly. All blot data are representative of at least three independent experiments.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Source link


Discover more from PressNewsAgency

Subscribe to get the latest posts sent to your email.

- Advertisment -